ID: 966767923_966767938

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966767923 966767938
Species Human (GRCh38) Human (GRCh38)
Location 3:183479106-183479128 3:183479159-183479181
Sequence CCAGCCTCCCAGGGGGTGGCTCT GGCACAGAGGCCATGGACCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!