ID: 966847169_966847175

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 966847169 966847175
Species Human (GRCh38) Human (GRCh38)
Location 3:184139633-184139655 3:184139675-184139697
Sequence CCACTGGGAGTCTCTTTGGAATT CATAGGGTTTGCTAGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 183} {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!