ID: 967117743_967117751

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 967117743 967117751
Species Human (GRCh38) Human (GRCh38)
Location 3:186356936-186356958 3:186356957-186356979
Sequence CCAACTCCCATCAGTAGGAGAGG GGGGAGAGTTGCTGGCTTCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 123} {0: 2, 1: 0, 2: 2, 3: 33, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!