ID: 967233037_967233042

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 967233037 967233042
Species Human (GRCh38) Human (GRCh38)
Location 3:187358974-187358996 3:187358997-187359019
Sequence CCTGGGCTACCACTTGGGAGAGG GAGCTGGAGAGAGCAGTGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 14, 3: 180, 4: 2569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!