ID: 967500343_967500348

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 967500343 967500348
Species Human (GRCh38) Human (GRCh38)
Location 3:190190280-190190302 3:190190324-190190346
Sequence CCCCAGTTTTCATTTCTAATATA CTACATAAACAGAAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 92, 4: 758} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!