ID: 968230796_968230820

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968230796 968230820
Species Human (GRCh38) Human (GRCh38)
Location 3:197003477-197003499 3:197003524-197003546
Sequence CCCCGAAGCCCGGGCCGCGGTGG TGGGGGTGGGGGCATCTTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126} {0: 1, 1: 0, 2: 5, 3: 50, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!