ID: 968230799_968230814

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 968230799 968230814
Species Human (GRCh38) Human (GRCh38)
Location 3:197003479-197003501 3:197003511-197003533
Sequence CCGAAGCCCGGGCCGCGGTGGCC GCCCGCTCTGGGGTGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178} {0: 1, 1: 0, 2: 8, 3: 255, 4: 3656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!