ID: 968230800_968230809

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968230800 968230809
Species Human (GRCh38) Human (GRCh38)
Location 3:197003485-197003507 3:197003504-197003526
Sequence CCCGGGCCGCGGTGGCCGCCTCA CTCAGGCGCCCGCTCTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 222} {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!