|
Left Crispr |
Right Crispr |
| Crispr ID |
968419234 |
968419242 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:468689-468711
|
4:468722-468744
|
| Sequence |
CCTTCTTCTCTGCAACCCCAGAG |
CAGCCTGGGGACCCAACAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 2, 2: 5, 3: 66, 4: 478} |
{0: 2, 1: 3, 2: 6, 3: 15, 4: 196} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|