ID: 968472002_968472017

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968472002 968472017
Species Human (GRCh38) Human (GRCh38)
Location 4:786680-786702 4:786705-786727
Sequence CCTTCTTCTTGATGCCGTACTGC GGGAGGCGGGGGTCAGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 1, 2: 14, 3: 155, 4: 1711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!