ID: 968472002_968472019

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 968472002 968472019
Species Human (GRCh38) Human (GRCh38)
Location 4:786680-786702 4:786712-786734
Sequence CCTTCTTCTTGATGCCGTACTGC GGGGGTCAGGGCGGGGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 8, 3: 132, 4: 1059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!