ID: 968472837_968472854

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968472837 968472854
Species Human (GRCh38) Human (GRCh38)
Location 4:789918-789940 4:789963-789985
Sequence CCACCCCAACAGGTGGCCACGCC CAACAGGTGGCCACGCCTGAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 147} {0: 4, 1: 0, 2: 1, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!