ID: 968472837_968472856

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968472837 968472856
Species Human (GRCh38) Human (GRCh38)
Location 4:789918-789940 4:789968-789990
Sequence CCACCCCAACAGGTGGCCACGCC GGTGGCCACGCCTGAAGGCAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 147} {0: 2, 1: 1, 2: 2, 3: 10, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!