ID: 968673416_968673423

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968673416 968673423
Species Human (GRCh38) Human (GRCh38)
Location 4:1864314-1864336 4:1864328-1864350
Sequence CCTTGGAGGCAGGAGCCACCTGG GCCACCTGGGGCCTGGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 380} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!