ID: 968673416_968673429

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968673416 968673429
Species Human (GRCh38) Human (GRCh38)
Location 4:1864314-1864336 4:1864340-1864362
Sequence CCTTGGAGGCAGGAGCCACCTGG CTGGGAGGCGGGGCAGCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 380} {0: 1, 1: 2, 2: 4, 3: 33, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!