ID: 968727350_968727364

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 968727350 968727364
Species Human (GRCh38) Human (GRCh38)
Location 4:2253926-2253948 4:2253959-2253981
Sequence CCAACAGGAGTGAGCGCCCTGCC CCAGGAACTGTGTAGGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120} {0: 1, 1: 0, 2: 2, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!