ID: 968727356_968727369

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 968727356 968727369
Species Human (GRCh38) Human (GRCh38)
Location 4:2253951-2253973 4:2253989-2254011
Sequence CCCCCACCCCAGGAACTGTGTAG GTGCTCTCTCTGCTCAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 278} {0: 1, 1: 1, 2: 3, 3: 20, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!