ID: 968727360_968727367

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968727360 968727367
Species Human (GRCh38) Human (GRCh38)
Location 4:2253954-2253976 4:2253985-2254007
Sequence CCACCCCAGGAACTGTGTAGGCA AAGCGTGCTCTCTCTGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 218} {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!