ID: 968883861_968883873

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 968883861 968883873
Species Human (GRCh38) Human (GRCh38)
Location 4:3317045-3317067 4:3317087-3317109
Sequence CCGAGTACCCGGCCGAGAAGCTG CGGACGACCGGCGATTTTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71} {0: 1, 1: 0, 2: 0, 3: 0, 4: 0}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!