ID: 968883864_968883873

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968883864 968883873
Species Human (GRCh38) Human (GRCh38)
Location 4:3317053-3317075 4:3317087-3317109
Sequence CCGGCCGAGAAGCTGGCCTTCAG CGGACGACCGGCGATTTTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 384} {0: 1, 1: 0, 2: 0, 3: 0, 4: 0}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!