ID: 969024339_969024345

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969024339 969024345
Species Human (GRCh38) Human (GRCh38)
Location 4:4161594-4161616 4:4161627-4161649
Sequence CCCCCAAGAGTTCAATAGGCCTT TCACACTCCATGCACTTGAAGGG
Strand - +
Off-target summary No data {0: 6, 1: 16, 2: 16, 3: 29, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!