|
Left Crispr |
Right Crispr |
| Crispr ID |
969162615 |
969162624 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:5274794-5274816
|
4:5274841-5274863
|
| Sequence |
CCGTCCACCACTGCTGTTTGCCG |
TCATCCCTCCAGATCCAGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 62, 1: 126, 2: 64, 3: 58, 4: 189} |
{0: 2, 1: 13, 2: 65, 3: 136, 4: 360} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|