|
Left Crispr |
Right Crispr |
Crispr ID |
969249708 |
969249716 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:5958988-5959010
|
4:5959036-5959058
|
Sequence |
CCTGGCCTCTACCCACCAGATGC |
ACCAAAAATGTCTCCAGACATGG |
Strand |
- |
+ |
Off-target summary |
{0: 24, 1: 250, 2: 688, 3: 1182, 4: 1566} |
{0: 19, 1: 56, 2: 83, 3: 122, 4: 333} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|