|
Left Crispr |
Right Crispr |
| Crispr ID |
969249709 |
969249716 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:5958993-5959015
|
4:5959036-5959058
|
| Sequence |
CCTCTACCCACCAGATGCCAGTA |
ACCAAAAATGTCTCCAGACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 242, 2: 719, 3: 1095, 4: 1544} |
{0: 19, 1: 56, 2: 83, 3: 122, 4: 333} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|