|
Left Crispr |
Right Crispr |
| Crispr ID |
969249714 |
969249716 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:5959023-5959045
|
4:5959036-5959058
|
| Sequence |
CCCAGCTGTGACAACCAAAAATG |
ACCAAAAATGTCTCCAGACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 40, 1: 226, 2: 605, 3: 865, 4: 1243} |
{0: 19, 1: 56, 2: 83, 3: 122, 4: 333} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|