|
Left Crispr |
Right Crispr |
| Crispr ID |
969473823 |
969473824 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:7409399-7409421
|
4:7409415-7409437
|
| Sequence |
CCAACAGCATGGTGCTGCTGAAC |
GCTGAACAGACACTCTGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 25, 2: 54, 3: 68, 4: 213} |
{0: 2, 1: 29, 2: 74, 3: 64, 4: 174} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|