|
Left Crispr |
Right Crispr |
Crispr ID |
969647242 |
969647244 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:8438909-8438931
|
4:8438927-8438949
|
Sequence |
CCTGCTCTGGTCACTCCGGAGGC |
GAGGCTGACCAGTCTACACACGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 12, 2: 14, 3: 31, 4: 186} |
{0: 3, 1: 6, 2: 19, 3: 43, 4: 154} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|