ID: 969685994_969686000

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 969685994 969686000
Species Human (GRCh38) Human (GRCh38)
Location 4:8674613-8674635 4:8674636-8674658
Sequence CCACACCGCAGACACTCACACAG CTCATGCTGGAGAGATGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 759} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!