ID: 969744497_969744504

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 969744497 969744504
Species Human (GRCh38) Human (GRCh38)
Location 4:9059489-9059511 4:9059510-9059532
Sequence CCCTCTCACACGGACCCCCTTAG AGAGTTGTGAGCCCTTAAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!