|
Left Crispr |
Right Crispr |
| Crispr ID |
969744497 |
969744504 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:9059489-9059511
|
4:9059510-9059532
|
| Sequence |
CCCTCTCACACGGACCCCCTTAG |
AGAGTTGTGAGCCCTTAAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 113, 2: 201, 3: 212, 4: 181} |
{0: 304, 1: 454, 2: 278, 3: 108, 4: 184} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|