ID: 969748370_969748375

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 969748370 969748375
Species Human (GRCh38) Human (GRCh38)
Location 4:9091752-9091774 4:9091776-9091798
Sequence CCGCAACAACCAAAACTGTCTCC GACATGGCCACATGTTCTCTGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 5, 3: 26, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!