ID: 969796825_969796835

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969796825 969796835
Species Human (GRCh38) Human (GRCh38)
Location 4:9533238-9533260 4:9533277-9533299
Sequence CCTGGGGCGCTGTCCCTGTGAGC ACGTGGGCCCCTGAGTCACCGGG
Strand - +
Off-target summary No data {0: 6, 1: 3, 2: 9, 3: 9, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!