ID: 970270898_970270905

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 970270898 970270905
Species Human (GRCh38) Human (GRCh38)
Location 4:14346292-14346314 4:14346335-14346357
Sequence CCCATCTTCCTACACCATTAGGG TCCTGACTCCCTTTGCACATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!