ID: 970532757_970532764

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 970532757 970532764
Species Human (GRCh38) Human (GRCh38)
Location 4:16999998-17000020 4:17000030-17000052
Sequence CCATGTCCCATCTGTGTGGGACC ATCGGACTGTTCAACTTACCTGG
Strand - +
Off-target summary {0: 82, 1: 298, 2: 258, 3: 133, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!