ID: 971170901_971170909

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 971170901 971170909
Species Human (GRCh38) Human (GRCh38)
Location 4:24231506-24231528 4:24231552-24231574
Sequence CCAAGCCCAGAAATCTTAGGAGA ACCCAGGCAACAAAGGTTTCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!