ID: 972333813_972333817

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 972333813 972333817
Species Human (GRCh38) Human (GRCh38)
Location 4:38087668-38087690 4:38087684-38087706
Sequence CCCGTCTCAACTGAAAATACAGA ATACAGAAATTAGCAGGGCATGG
Strand - +
Off-target summary {0: 2, 1: 179, 2: 9450, 3: 182980, 4: 211969} {0: 14, 1: 1339, 2: 35330, 3: 84164, 4: 117308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!