ID: 972516981_972516986

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 972516981 972516986
Species Human (GRCh38) Human (GRCh38)
Location 4:39818216-39818238 4:39818253-39818275
Sequence CCTTGTCATTAAGACAACCTCCA AGAGAGAAGAAAATGAGGCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!