ID: 973102922_973102925

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 973102922 973102925
Species Human (GRCh38) Human (GRCh38)
Location 4:46294720-46294742 4:46294760-46294782
Sequence CCTGCCATCTTCTGCAGATAACT GACAGCTCTTGGCCCATTACTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 6, 1: 25, 2: 183, 3: 198, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!