ID: 973118435_973118443

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 973118435 973118443
Species Human (GRCh38) Human (GRCh38)
Location 4:46489012-46489034 4:46489051-46489073
Sequence CCCTGCCATCTTCTGCAGATAAC GGCAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 9, 1: 173, 2: 187, 3: 147, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!