|
Left Crispr |
Right Crispr |
| Crispr ID |
973143629 |
973143633 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:46798170-46798192
|
4:46798183-46798205
|
| Sequence |
CCTCAGTGAAATTTCTAGGAGTC |
TCTAGGAGTCTAGTGGTATGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 35, 2: 187, 3: 219, 4: 306} |
{0: 1, 1: 3, 2: 30, 3: 165, 4: 300} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|