|
Left Crispr |
Right Crispr |
| Crispr ID |
973143677 |
973143682 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:46798575-46798597
|
4:46798614-46798636
|
| Sequence |
CCCTGCCATGATCTGCAGAAAGC |
AATAGCTCTTGGCCTGCTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 1, 3: 33, 4: 419} |
{0: 3, 1: 12, 2: 50, 3: 260, 4: 350} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|