ID: 973954381_973954383

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 973954381 973954383
Species Human (GRCh38) Human (GRCh38)
Location 4:56048931-56048953 4:56048946-56048968
Sequence CCTGGGGAGGGGAGCCATCTGGT CATCTGGTGTGCGCCACTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!