ID: 973981866_973981881

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 973981866 973981881
Species Human (GRCh38) Human (GRCh38)
Location 4:56314482-56314504 4:56314528-56314550
Sequence CCCAAGCGGAGGAGAGGCGGCGG GGAGCGGAGGCGGCAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135} {0: 1, 1: 0, 2: 17, 3: 164, 4: 1594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!