ID: 973981868_973981874

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 973981868 973981874
Species Human (GRCh38) Human (GRCh38)
Location 4:56314483-56314505 4:56314507-56314529
Sequence CCAAGCGGAGGAGAGGCGGCGGC GGAGGAGGACGCCAGGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 214} {0: 1, 1: 0, 2: 5, 3: 76, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!