ID: 974481183_974481189

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 974481183 974481189
Species Human (GRCh38) Human (GRCh38)
Location 4:62445742-62445764 4:62445760-62445782
Sequence CCATAGACAAAAGTTCCTTTGTG TTGTGGGAGTTTTGGGATTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 7, 3: 30, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!