ID: 974779077_974779084

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 974779077 974779084
Species Human (GRCh38) Human (GRCh38)
Location 4:66528330-66528352 4:66528369-66528391
Sequence CCCCTACACTAGAGATTTGTGGA AGGTGATTTAGGGCATCTGGTGG
Strand - +
Off-target summary No data {0: 3, 1: 68, 2: 747, 3: 1061, 4: 839}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!