ID: 975106626_975106636

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 975106626 975106636
Species Human (GRCh38) Human (GRCh38)
Location 4:70574565-70574587 4:70574605-70574627
Sequence CCCTATCATGAGCTACATATGTC TGAGCCATGTGTTAGGTTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!