|
Left Crispr |
Right Crispr |
| Crispr ID |
975140877 |
975140882 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:70917081-70917103
|
4:70917114-70917136
|
| Sequence |
CCTTGGAAAAAGGACCTAACAAA |
TTAGAACAGTGAAGGCCTCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 39, 1: 40, 2: 27, 3: 29, 4: 254} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|