ID: 975521625_975521632

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 975521625 975521632
Species Human (GRCh38) Human (GRCh38)
Location 4:75307707-75307729 4:75307727-75307749
Sequence CCAGTGCACCGTGAACCTGCTTC TTCAGAGGGGTTCAAGCATTGGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 57, 3: 72, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!