ID: 975732779_975732795

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 975732779 975732795
Species Human (GRCh38) Human (GRCh38)
Location 4:77354020-77354042 4:77354065-77354087
Sequence CCTCAGCCAGGCAGCCTCCAGAG GGCAGGGAGTGGGGCTTTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 83, 4: 514} {0: 2, 1: 0, 2: 6, 3: 72, 4: 755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!