ID: 975848043_975848057

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 975848043 975848057
Species Human (GRCh38) Human (GRCh38)
Location 4:78546192-78546214 4:78546238-78546260
Sequence CCTCCCTGCTTCCTTCTGCCTTG TCCCTGGCCACAGGTGTCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!